Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0005912 | |||
Gene | FIP1L1 | Organism | Human |
Genome Locus | chr4:54265896-54294350:+ | Build | hg19 |
Disease | Basal Cell Carcinoma | ICD-10 | Malignant neoplasm of skin, unspecified (C44.9) |
DBLink | Link to database | PMID | 27097056 |
Experimental Method | |||
Sample Type | Tissues | Comparison | 6 nodular basal cell carcinoma (6 BCC), and 6 nonlesional epithelial skin (NLES), serving as control were enrolled in this study |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward AATTTTAGCAAACCACCTCCGT ReverseTCTGAGTTTCCAGTTCTTCCC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Sand, M, Bechara, FG, Sand, D, Gambichler, T, Hahn, SA, Bromba, M, Stockfleth, E, Hessam, S (2016). Circular RNA expression in basal cell carcinoma. Epigenomics, 8, 5:619-32. |